Clinical specimens and cell lines
Human gliomas and surrounding normal brain tissues requiring decompression were collected from the Xinxiang Central Hospital in Henan Province. Written informed consent was obtained from all patients or their relatives. All work was granted approval by the Medical Ethics Committee of Xinxiang Central Hospital. Tissue specimens were frozen in liquid nitrogen and stored at -80°C. The glioma cell line used in this study was obtained from ATCC, and cultured in RPMI 1640 (Hyclone) containing 10% Fetal Bovine Serum (FBS) (Gibco) at 37°C and 5% CO2.
RNA extraction and qRT-PCR
RNA was extracted using the TRIZol reagent (Takara). The cDNA was synthesized using the Takara reverse transcription kit. Real-time quantitative RT-PCR experiments were performed using cDNA as the template. SYBR Green I (Takara) was added, and the primers were mixed. The mixture was run on Applied Biosystems 7500/7500 Fast (Applied Biosystems), with GAPDH as the internal control. All experiments were repeated three times. SPI1 reaction conditions were as follows: 95°C for 5 min, 40 cycles at 95°C for 1 min, Tm of 30 s, and then 72°C for 34 s. The ΔCt method was used to calculate relative expression of SPI1. The ΔCt values were used to compare the expression level of SPI1 in tumor vs the control group. ΔCt = CtSPI1 – CtGAPDH. The SPI1 primers are listed as follows. The forward primer was 5′- GCGACCATTACTGGGACTTCC - 3′ and the reverse primer was 5′- GGGTATCGAGGACGTGCAT -3′. GAPDH was used as an internal control. The primers for GAPDH were 5′- GACTCATGACCACAGTCCATGC - 3′ and 5′- AGAGGCAGGGATGATGTTCTG -3′.
Construction of a SPI1-knockdown cell lines and transfection
The SPI1 siRNA was purchased from Gene Pharmaceutical (Shanghai, China). The nucleotide sequence for the SPI1 siRNA is 5'- GAGAGCTTCGCCGAGAACAACTTCA-3'. Transfection of siRNA oligonucleotides and plasmids was conducted with Lipofectamine 2000, which was purchased from Invitrogen, ThermoFisher Scientific (Catalog No.11668019, Massachusetts, USA).
Transwell assays
Cultured cells in the logarithmic phase were digested by trypsin in order to make single cell suspension waves. The cell concentration was adjusted to (1-2)×l05/mL. Next, 100 μl of the cell suspension was added to the upper chamber, and then 500 μl containing 10% of newborn bovine serum was added to the lower chamber. The cells were cultured for 48h at 37°C. The small chamber was taken out, fixed with 4% paraformaldehyde for 20 min, and stained with Giemsa for 15 min. Under the microscope, 5 fields were randomly chosen to count the number of cells that passed through the membrane in a 200X microscope. The influence of changes in SPI1 expression on cell migration was compared. The transwell chamber was purchased from Corning, Inc., USA.
Wound healing assay
Cultured cells in the logarithmic state were seeded onto a 6-well plate with 8x105 cells per well at 1-2 days before the experiment. The cells were incubated at 37°C in a 5% CO2 incubator. When the cells were grown to approximately 90% confluency, a 200 μl sterile spear was used to create a scratch on the 6-well plate. The liquid was then gently shaken and discarded to remove the floating cells. Pictures were taken under an inverted microscope at 10-times the field of view. Cell migration at the scratch was recorded at different time points.
Cell cycle detection
The transfected cells were collected and centrifuged at 4°C. The supernatant was discarded, and fixed with pre-cooled 70% ethanol for 24 h. Then, the cells were washed with PBS. Next, 10 μl of RNase A solution was added to each sample, as well as 40 μl of PBS, according to the instructions of the cell cycle detection kit. The mixture was placed in the water bath at 37°C for 30 min. The red fluorescence at the excitation wavelength of 488nm was recorded by flow cytometry.
Cell apoptosis detection
Cell apoptosis was evaluated by Annexin V/PI double labeling. The cells were digested and collected, washed twice with PBS, and made resuspended into a single cell suspension. Cell suspension was then incubated with Annexin V-FITC and PI at room temperature, and placed in the dark for 15 min. Flow cytometry was utilized to determine the results, and the CellQuest analysis software helped analyze the results.
Double luciferase activity assay
The Dual-Luciferase ReporterAssay System (Catalog No. E1910) of Promega was utilized to quantify dual luciferase activity. Additionally, 48h after the plasmid was transfected, the medium was removed and washed twice with PBS. Next, 65 μl of 1× Passive Lysis Buffer (PLB) was added to each well. Then, the cell lysates were collected after gentle vibration at room temperature for 15 min. We utilized an automatic luminous detector, which required adding 20 μl of the cell lysate to each hole, and then adding 100 μl of LAR II to automatically detect the fluorescence value of firefly (F). After adding a 100 μl of the STOP&Glo@Reagent, the fluorescence value (R) was determined immediately. After reading the value, the data was saved for analysis of the detection results.
Chromatin immunoprecipitation (ChIP)
ChIP assays were carried out according to the EZ-CHIP kit (Millipore, Temecula, CA, USA). The anti-SPI1 (Abclone) antibodies were utilized to precipitate the DNA-protein complex. The immunoprecipitated DNA was evaluated by PCR. Primers that were specific to the PAICS promoter containing E-box were 5’-TAAAGTTCATGGAAGCGAGGTG-3’ (forward) and 5’- TCACTCTGGGACTCGTGGG-3’ (reverse).
Statistical analysis
Data was analyzed using the SPSS 20.0 statistical software. Quantitative data was presented as mean ± SD of at least three independent experiments. The differences between the independent experimental groups were assessed using a two-tailed Student's t-test. Differences were considered significant if p < 0.05*, p < 0.01**, p < 0.001***.
